Ginkgo Investor Conference Presentation Deck

Made public by

Ginkgo

sourced by PitchSend

37 of 41

Creator

ginkgo

Category

Healthcare

Published

June 2021

Slides

Transcriptions

#1Grow with Ginkgo Anna Marie Wagner, SVP Corporate Development [email protected] RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS#2DISCLAIMER Disclaimer This confidential presentation (the "presentation") is being delivered to you by Soaring Eagle Acquisition Corp. ("SRNG") and Ginkgo Bioworks, Inc. ("Ginkgo") for use by Ginkgo and SRNG in connection with their proposed business combination and the offering of the securities of the post-business combination company in a private placement (the "Transaction"). This presentation is for information purposes only and is being provided to you solely in your capacity as a potential investor in considering an investment in Ginkgo. Any reproduction or distribution of this presentation, in whole or in part, or the disclosure of its contents, without the prior consent of Ginkgo is prohibited. By accepting this presentation, each recipient agrees (on behalf of itself and each of its directors, partners, officers, employees, attorneys, financial advisors, agents and representatives (each of the foregoing, a "representative") agrees: (i) to maintain (and direct its representatives to maintain) the confidentiality of all information that is contained in this presentation and not already in the public domain; and (ii) to return or destroy (and direct its representatives to return or destroy) all copies of this presentation or portions thereof in its possession following the request for the return or destruction of such copies. Neither this presentation nor any oral statements made in connection with this presentation shall constitute an offer to sell or the solicitation of an offer to buy any securities, or the solicitation of any proxy, vote, consent or approval, in any jurisdiction in connection with the proposed business combination, nor shall there be any sale of securities in any jurisdiction in which the offer, solicitation or sale would be unlawful prior to the registration or qualification under the securities laws of any such jurisdiction. This communication is restricted by law; it is not intended for distribution to, or use by any person in, any jurisdiction where such distribution or use would be contrary to local law or regulation. No Representations or Warranties This presentation is for informational purposes only and does not purport to contain all of the information that may be required to evaluate a possible investment decision with respect to Ginkgo. The recipient agrees and acknowledges that this presentation is not intended to form the basis of any investment decision by the recipient and does not constitute investment, tax or legal advice. No representation or warranty, express or implied, is or will be given by SRNG or Ginkgo or any of their respective affiliates, directors, officers, employees or advisers or any other person as to the accuracy or completeness of the information in this presentation or any other written, oral or other communications transmitted or otherwise made available to any party in the course of its evaluation of a possible transaction between SRNG and Ginkgo and no responsibility or liability whatsoever is accepted for the accuracy or sufficiency thereof or for any errors, omissions or misstatements, negligent or otherwise, relating thereto. The recipient also acknowledges and agrees that the information contained in this presentation is preliminary in nature and is subject to change, and any such changes may be material. SRNG and Ginkgo disclaim any duty to update the information contained in this presentation. Forward-Looking Statements This presentation includes "forward-looking statements" within the meaning of the "safe harbor" provisions of the Private Securities Litigation Reform Act of 1995. SRNG's and Ginkgo's actual results may differ from their expectations, estimates and projections, and, consequently, you should not rely on these forward-looking statements as predictions of future events. Words such as "expect," "estimate," "project," "budget," "forecast," "anticipate," "intend," "plan," "may," "will," "could," "should," "believes," "predicts," "potential," "continue," and similar expressions are intended to identify such forward-looking statements. These forward-looking statements include, without limitation, SRNG's and Ginkgo's expectations with respect to future performance and anticipated financial impacts of the Transaction, the satisfaction of closing conditions to the Transaction and the timing of the completion of the Transaction. These forward-looking statements involve significant risks and uncertainties that could cause the actual results to differ materially from the expected results. You should carefully consider the risks and uncertainties described in the "Risk Factors" section of SRNG's registration statement on Form S-1. In addition, there will be risks and uncertainties described in the proxy statement/prospectus on Form S-4 relating to the Transaction, which is expected to be filed by Ginkgo with the Securities and Exchange Commission (the "SEC"), and other documents filed by SRNG from time to time with the SEC. These filings identify and address other important risks and uncertainties that could cause actual events and results to differ materially from those contained in the forward-looking statements. Most of these factors are outside SRNG's and Ginkgo's control and are difficult to predict. Factors that may cause such differences include, but are not limited to: (1) the outcome of any legal proceedings that may be instituted against SRNG or Ginkgo following the announcement of the Transaction; (2) the inability to complete the Transaction, including due to the inability to concurrently close the business combination and the private placement of common stock or due to failure to obtain approval of the stockholders of SRNG; (3) delays in obtaining, adverse conditions contained in, or the inability to obtain necessary regulatory approvals, or delays in completing regulatory reviews, required to complete the Transaction; (4) the risk that the Transaction disrupts current plans and operations as a result of the announcement and consummation of the Transaction; (5) the inability to recognize the anticipated benefits of the Transaction, which may be affected by, among other things, competition, the ability of the combined company to grow and manage growth profitably, maintain relationships with customers and suppliers and retain key employees; (6) costs related to the Transaction; (7) changes in the applicable laws or regulations; (8) the possibility that the combined company may be adversely affected by other economic, business, and/or competitive factors; (9) the impact of the global COVID-19 pandemic; (10) the risks described in the Appendix hereto; and (11) other risks and uncertainties indicated from time to time described in SRNG's registration on Form S-1, including those under "Risk Factors" therein, and in SRNG's other filings with the SEC. SRNG and Ginkgo caution that the foregoing list of factors is not exclusive and not to place undue reliance upon any forward-looking statements, including projections, which speak only as of the date made. Neither SRNG nor Ginkgo undertakes or accepts any obligation to release publicly any updates or revisions to any forward-looking statements to reflect any change in its expectations or any change in events, conditions or circumstances on which any such statement is based. Industry and Market Data In this presentation, SRNG and Ginkgo rely on and refer to certain information and statistics regarding the markets and industries in which Ginkgo competes. Such information and statistics are based on Ginkgo's management's estimates and/or obtained from third-party sources, including reports by market research firms and company filings. While Ginkgo believes such third-party information is reliable, there can be no assurance as to the accuracy or completeness of the indicated information. Neither Ginkgo nor SRNG has independently verified the accuracy or completeness of the information provided by the third-party sources. 2#3DISCLAIMER Trademarks This presentation may contain trademarks, service marks, trade names and copyrights of other companies, which are the property of their respective owners, and SRNG's and Ginkgo's use thereof does not imply an affiliation with, or endorsement by, the owners of such trademarks, service marks, trade names and copyrights. Solely for convenience, some of the trademarks, service marks, trade names and copyrights referred to in this presentation may be listed without the TM, Ⓒ or ® symbols, but SRNG and Ginkgo will assert, to the fullest extent under applicable law, the rights of the applicable owners, if any, to these trademarks, service marks, trade names and copyrights. Private Placement The securities to which this presentation relate have not been registered under the Securities Act of 1933, as amended (the "Securities Act"), or the securities laws of any other jurisdiction. This presentation relates to securities that SRNG intends to offer in reliance on exemptions from the registration requirements of the Securities Act and other applicable laws. These exemptions apply to offers and sales of securities that do not involve a public offering. The securities have not been approved or recommended by any federal, state or foreign securities authorities, nor have any of these authorities passed upon the merits of this offering or determined that this presentation is accurate or complete. Any representation to the contrary is a criminal offense. Financial Information This presentation contains certain estimated preliminary financial results and key operating metrics for the year ended December 31, 2020, and the historical financial information with respect to Ginkgo contained in this presentation has been taken from or prepared based on historical financial statements of Ginkgo, including unaudited financial statements for its fiscal year ended December 31, 2020. This information is preliminary and subject to adjustment in connection with the completion of the audit for the fiscal year ended December 31, 2020. As such, Ginkgo's actual results and financial condition as reflected in the financial statements that will be included in the proxy statement/prospectus on Form S-4 for the proposed Transaction may be adjusted or presented differently from the historical financial information herein, and the variations could be material. Non-GAAP Financial Measures Certain of the financial measures included in this presentation, including Foundry Billable Revenue, Foundry Billable Revenue Growth, Net Present Value (NPV) and Adjusted EBITDA, have not been prepared in accordance with general accepted accounting principles ("GAAP"), and constitute "non-GAAP financial measures" as defined by the SEC. Ginkgo has included these non-GAAP financial measures (including on a forward-looking basis) because it believes they provide an additional tool for investors to use in evaluating the financial performance and prospects of Ginkgo or any successor entity in the Transaction. These non-GAAP financial measures should not be considered in isolation from, or as an alternative to, financial measures determined in accordance with GAAP. In addition, these non-GAAP financial measures may differ from non-GAAP financial measures with comparable names used by other companies. See the Appendix for a description of these non-GAAP financial measures and a reconciliation of the historic measures to Ginkgo's most comparable GAAP financial measures. Note however, that to the extent forward-looking non-GAAP financial measures are provided herein, they are not reconciled to comparable forward-looking GAAP measures due to the inherent difficulty in forecasting and quantifying certain amounts that are necessary for such reconciliation. Use of Projections This presentation also contains certain financial forecasts, including projected Foundry Billable Revenue, Foundry Billable Revenue Growth, Foundry Revenue (GAAP), Biosecurity Revenue, Total GAAP Revenue, Adjusted EBITDA and CapEx. Neither SRNG's nor Ginkgo's independent auditors have studied, reviewed, compiled or performed any procedures with respect to the projections for the purpose of their inclusion in this presentation, and, accordingly, neither of them have expressed an opinion or provided any other form of assurance with respect thereto for the purpose of this presentation. These projections are for illustrative purposes only and should not be relied upon as being necessarily indicative of future results. In this presentation, certain of the above-mentioned projected information has been provided for purposes of providing comparisons with historical data. The assumptions and estimates underlying the prospective financial information are inherently uncertain and are subject to a wide variety of significant business, economic and competitive risks and uncertainties that could cause actual results to differ materially from those contained in the prospective financial information. Projections are inherently uncertain due to a number of factors outside of SRNG's or Ginkgo's control. While all financial projections, estimates and targets are necessarily speculative, SRNG and Ginkgo believe that the preparation of prospective financial information involves increasingly higher levels of uncertainty the further out the projection, estimate or target extends from the date of preparation. Accordingly, there can be no assurance that the prospective results are indicative of future performance of the combined company after the Transaction or that actual results will not differ materially from those presented in the prospective financial information. Inclusion of the prospective financial information in this presentation should not be regarded as a representation by any person that the results contained in the prospective financial information will be achieved. Participation in Solicitation SRNG and Ginkgo and their respective directors and executive officers may be deemed under SEC rules to be participants in the solicitation of proxies of SRNG's shareholders in connection with the proposed Transaction. Investors and security holders may obtain more detailed information regarding the names and interests in the proposed Transaction of SRNG's directors and officers in SRNG's filings with the SEC, including SRNG's registration statement on Form S-1, which was originally filed with the SEC on December 23, 2020. To the extent that holdings of SRNG's securities have changed from the amounts reported in SRNG's registration statement on Form S-1, such changes have been or will be reflected on Statements of Change in Ownership on Form 4 filed with the SEC. Information regarding the persons who may, under SEC rules, be deemed participants in the solicitation of proxies to SRNG's shareholders in connection with the proposed Transaction will be set forth in the proxy statement/prospectus on Form S-4 for the proposed Transaction, which is expected to be filed by SRNG with the SEC. Investors and security holders of SRNG and Ginkgo are urged to read the proxy statement/prospectus and other relevant documents that will be filed with the SEC carefully and in their entirety when they become available because they will contain important information about the proposed Transaction. Investors and security holders will be able to obtain free copies of the proxy statement and other documents containing important information about SRNG and Ginkgo through the website maintained by the SEC at www.sec.gov. Copies of the documents filed with the SEC by SRNG can be obtained free of charge by directing a written request to SRNG, 955 Fifth Avenue, New York, NY 10075. 3#44 Imovincess wwww Make biology easier to engineer Fa Banda GINKGO BIOWORKS RAYMOND JAMES | JUNE 2021 Our Mission#5Tom Knight with his master's thesis, a "minicomputer" FARE PROCESSOR MIT, 1972 We can program cells (DNA) like we program computers (code) LIVE MIT DEMO BL1 +) {H}};$ CAL u de coli ALLEGRA GOODMAN NOVELIST 2006 GINKGO BIOWORKS THE ORGANISM COMPANY 2019 ZY 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 5#6Combining an industry-defining founding team with proven executives who have built iconic public companies Founding team has been working together for nearly 20 years I Barry Canton CTO Jason Kelly CEO Austin Che Strategy Reshma Shetty COO Marijn Dekkers Chairman, Governance/Nominating Chair Board member since 2019 Fmr Chairman, Unilever (NYSE:UL) Fmr CEO, Bayer (XTRA:BAYN) Fmr CEO, Thermo Fisher (NYSE:TMO) Tom Knight DNA Hacker Harry Sloan CEO, Chairman with Soaring Eagle brings a track record of success in SPACs With long-term support from a deeply experienced, industry-leading independent board Christian Henry Audit Committee Chair Board member since 2016 Jeff Sagansky Partner President/CEO, PacBio (Nasdaq:PACB) Fmr CFO/CCO, Illumina (Nasdaq:ILMN) Eli Baker President, CFO Arie Belldegrun Founder, Fmr CEO/Chairman, Kite Pharma Founder, Chairman, Allogene Shyam Sankar Compensation Committee Chair Board member since 2016 COO, Palantir (NYSE: PLTR) 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 6#7Cell programming is increasingly impacting our lives ishte e pare the love her Vaccines are developed and manufactured using cell programming tools Ginkgo's work to close raw material gaps in the mRNA vaccine supply chain was recently featured on 60 Minutes 60 MINUTES MORSE GROUP RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 7#8Cell programming is addressing our most challenging environmental and social issues Pharma & Biotech Antibody therapeutic development Antibiotic discovery and manufacturing Nucleic acid vaccine production Read "Microscopic Doctors" on Grow Microbiome therapeutics Gene and cell therapies O 3 GOOD HEALTH AND WELL-BEING W Industrials & Environment Wastewater remediation PFAS degradation Renewable chemicals Sustainable building materials Carbon sequestration Read "Anatomy of an Underground Wildfire" on Grow 6 CLEAN WATER AND SANITATION 13 Food & Agriculture Sugar reduction CLIMATE Animal protein replacement and we're just getting started... Brewing & baking Pest control Fertilizer reduction Animal feed and aquaculture Read "Redesigning 7 the Banana" on Grow 2 HUNGER SSS LIFF 14 BELOW MATER — LIFE 15 ON LAND Consumer & Technology Plant extracts: flavors, fragrances, cannabinoids Skin microbiome (protection and beauty) Haircare and skincare proteins Read "Ingredient 7 Revolution" on Grow Textiles and dyes Electronic coatings 11 SUSTAINABLE CITIES AND COMMUNITIES AB A 12 RESPONSIBLE CONSUMPTION AND PRODUCTION 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 8#9We believe... 1 Programming cells will be as impactful as programming computers The same underlying technology can be used to create applications across all physical goods industries. Ginkgo is the first horizontal platform in this industry, supporting all end markets. 2 Ginkgo's platform improves with scale Each new program drives platform improvements, leading to more demand. 3 Ginkgo is becoming the industry standar We believe Ginkgo's ecosystem of services will make us the obvious partner in the enormous, and largely untapped, market for cell programming. 4 Our value increases with each new program added to the platform Each new program adds predictable near-term revenue from usage fees and provides Ginkgo upside through value share. RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 9#10We believe... 1 Programming cells will be as impactful as programming computers The same underlying technology can be used to create applications across all physical goods industries. Ginkgo is the first horizontal platform in this industry, supporting all end markets. 2 Ginkgo's platform improves with scale 3 Ginkgo is becoming the industry standard 4 Our value increases with each new program added to the platform RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 10#11Cargill ADM motif FOODWORKS SUMITOMO ALLONNIA KERRY genomatica AJINOMOTO. Thermo Fisher SCIENTIFIC PACIFIC BIOSCIENCES Roche moderna JOYN BIOE agriscience CORTEVA™ A LABCYTE BAYER Ginkgo is building the leading horizontal platform for cell programming across all industries swissaustral Unlock the Power of Nature TWIST BIOSCIENCE synlogic HAMILTON any TOTIENT 6 BERKELEY LIGHTS PROGRAM LAYER Ginkgo provides program management and technical execution to product companies across all industries LEARN MORE PLATFORM LAYER Ginkgo is the interface between a series of complex technologies and a customer spec LEARN MORE 7 TECHNOLOGY LAYER Ginkgo integrates standard hardware and wraps it in proprietary software and automation RAYMOND JAMES | JUNE 20 21 GINKGO BIOWORKS 11#12We program cells for our customers so they can develop new products Ginkgo Foundry Input Customer Specs Recursive Learning SOFTWARE HARDWARE ORGANISMS Design, Write, & Debug DNA Code ACTGGATA CCTGAGAT AUTOMATION GENETIC CODE BIOLOGICAL TOOLS Continuous Improvement Output Cell Program Ginkgo Codebase 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 12#13Over 70 major customer programs across diverse industries have run on our platform Cumulative Major 3rd Party Programs 80 60 40 20 0 PRE-2015: GOVERNMENT PROGRAMS First 5+ years of technology building funded through non-dilutive government programs (DARPA, SBIR, etc.) CONSUMER & TECHNOLOGY Early experimentation making fine chemicals for flavors & fragrances Gaining traction within increasingly sophisticated end markets + INDUSTRIAL & ENVIRONMENT Experience in flavors & fragrances enabled expansion into industrial chemicals + FOOD & NUTRITION Motif (Louis Dreyfus and Fonterra) launches portfolio of animal-free protein programs + AGRICULTURE Selection by Bayer for agriculture JV after significant industry vetting 2018 + PHARMA & BIOTECH Mammalian capabilities & Synlogic partnership 2015 2016 2017 ■Consumer & Technology Industrial & Environment Agriculture Food & Nutrition Pharma & Biotech Government & Defense 2019 = DIVERSIFIED PLATFORM Can respond rapidly to emerging opportunities and global threats Note: "Major" programs exclude proof of concept work and ancillary projects and typically have at least $500K actual / expected development costs on behalf of a customer 2020 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 13#14Market defining customers have validated the platform across a wide range of end markets 24 13:56 28 CONSUMER & TECH Fragrances (G4, G41, G53) Cannabinoids (G102, G123) Insect Repellent (G166) High-tech electronics (G37, G43) RC ROBERTET CRONOS GROUP INDUSTRIALS & ENVIRONMENT Commodities & Specialty Chemicals (G15, G24, G48, G51, G90, G101, G116, G127, G134, G142, G159) Textiles (G36) Environment (G131, G138, G145, G153, G164, G171) Cargill genomatica AGRICULTURE Fertilizers & Crop Enhancement (G50, G81, G133) Crop Protection (G99, G119, G132, G151, G163, G165) Animal Feed (G16, G68, G71, G146) CORTEVA™ agriscience B JOYN BAYER BIO R Note: Reflects a portion of current / completed programs; program codes have been anonymized FOOD & NUTRITION Animal-free proteins (G114, G121, G122, G128, G136, G162) Flavors & Sweeteners (G49, G56, G125, G174) Nutrition (G35, G69, G109) Brewing & Baking (G52, G95, G97) Aj AJINOMOTO. KERRY motif FOODWORKS PHARMA & BIOTECH Microbiome Therapeutics (G40, G83, G139, G143, G147, G150, G152) Biologics & Gene Therapy (G66, G70, G115, G185) Antibiotics & APIs (G21, G67, G72, G86, G111) COVID Vaccines & Therapeutics (G155, G157, G158, G163, G165, G169, G170) Roche moderna synlogic P Biogen. RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 14#15Ginkgo's platform is exploring diverse applications with a broad range of partners Therapeutics & Vaccines Non-Therapeutics MAJOR PHARMA Enzyme Discovery moderna MULTIPLE PARTNERS Bio-process Optimization JOYN BIO Bio-agriculture Microbial Hosts Cargill KERRY Industrial Enzymes R ROBERTET CRONOS GROUP Plant Extracts synlogic Living Therapeutics Roche Antibiotics Discovery Animal Protein MADE FROM PLANTS! motif FOODWORKS Glycosyn DARPA Circuits Mammalian Hosts OTOTIENT Antibody Therapeutics WIRED Biogen. Gene Therapy MEGAN MOLTENI SCIENCE 10.24.18 12:47 PM GINKGO BIOWORKS IS TURNING HUMAN CELLS INTO ON-DEMAND FACTORIES DENNIS KUNKEL/SCIENCE SOURCE RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 15#16Ginkgo's platform has broad capabilities to accelerate and expand therapeutics discovery and manufacturing Our platform is well-suited to address problems that require large- scale, systematic, and model-driven exploration of genetic design spaces EXAMPLE CAPABILITIES Strain Improvement Antigen Design & Selection HT Antibody Selection & Optimization Enzyme Discovery & Optimization HT Car Cassette Design & Expression Engineered Disease Models Synthetic Promoter and Logic-gate Engineered Mammalian Cells EXAMPLE APPLICATIONS Antibody & Therapeutics Vaccines Gene-coded Therapeutics Cell Based Therapies RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 16#17R&D spending alone accounts for nearly $40B in untapped demand Existing market for cell engineering lab operations ($B) $60 $50 $40 $30 $20 $10 $0 ■Cell Engineering Labor Cell Engineering Tools $28B $10 $17 2019 $33B $12 $21 2020E Source: Piper Sandler Research 20% CAGR $40B $15 $25 2021E $48B $18 $30 2022E $58B $22 $36 2023E Our scale dramatically reduces costs We bring efficiency to scientists at the bench (1) Assumes approximately $2M annual expense per program, in line with current average annual spend per program at Ginkgo This market represents over 20,000+ potential new cell programs (1) 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 17#18$2 to $4 trillion emerging market for bioengineered products Programming biology is to the physical world what programming computers is to the information economy Annual Direct Economic Impact By Domain 2030-2040 (partial estimate) $1.2T $500B Health $1.2T $800B Food & Agriculture $700B $200B Consumer High Estimate Low Estimate + significant secondary effects not measured $300B $200B Materials & Energy $300B $100B Other Source: McKinsey Global Institute; The Bio Revolution: Innovations transforming economies, societies, and our lives (May 13, 2020) Note: these estimates reflect the estimated biotechnology penetration of these end-markets 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 18#19We believe... 1 Programming cells will be as impactful as programming computers 2 Ginkgo's platform improves with scale Each new program drives platform improvements, leading to more demand. 3 Ginkgo is becoming the industry standard 4 Our value increases with each new program added to the platform RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 19#202012 The Foundry - Ginkgo's physical infrastructure – drives a strong scale economic Build Build 2016 BW1 Early stages of building higher scale workflows and testing automated techniques BW2 2018 BW3 Created scale modules by function (e.g. DNA synthesis, -omics, sequencing, fermentation, etc.) 2019 Added mammalian cell engineering capabilities BW4 2020 Lab-scale automation and significantly increased NGS capacity BW5 KNIGHT'S LAW - our scale theory "The cost to genetically engineer a cell decreases by 50% and the number of designs tested increases by 3X+ per year in Ginkgo's automated cell programming foundries." RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 20#21Ginkgo's Foundry is scaling roughly 3x per year LAB OPERATIONS: MEASURING WORK DONE ON THE PLATFORM 1,000,000 Daily Lab Operations 100,000 10,000 1,000 100 2-3x annual increase pre-COVID 2014 2015 2016 2017 2018 2019 2020 2021 STRAIN TESTS: MEASURING THE OUTPUT OF THE PLATFORM 10,000,000 1,000,000 Daily Strain Tests 100,000 10,000 1,000 100 10 DEVELOPMENT AND ADOPTION OF NEW TECHNOLOGIES ENABLES ORDER OF MAGNITUDE IMPROVEMENTS IN CAPACITY 3-4x annual increase pre-COVID 2015 2016 2017 2018 2019 2020 2021 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 21#22Unit costs to program cells have decreased by 50% per year Cost per Strain Test (rolling 3mo avg) $10,000 $1,000 $100 $10 $1 2015 2016 2017 2018 2019 FOUNDRY IS 5-10X CHEAPER THAN THE STATUS QUO 000 COVID impact 2020 Note: Costs include all operational and R&D-related activities (i.e. both current programs and investments in future capacity) 2021 ESTIMATED "BY HAND" COST BY 2025, WE SHOULD BE TWO ORDERS OF MAGNITUDE MORE EFFICIENT THAN "BY HAND" 2025 RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 22#23Codebase - Ginkgo's scale data asset - is a source of long-term competitive advantage 3.4B+ 440M unique gene sequences pulled from all public databases Organisms proprietary gene sequences acquired And growing... codebase accumulates as we run new experiments in the foundry and build new: IGUAL ATGTTCGGATG. TTTGTGCCAACATA TGTCCAAAGAAAAGGO GAGCTTGGGAATTGAGT1 ATTCCATTAGACATTAGCC CAAGGAAACAATTGAAAGC! TGAAGGAAAAGAGTATCGT AGCTTCTGAATGAGCAACA GTGGTCTGCGTCACGGGT TCCGGCTACATTGCTT \CTCGTCAAGCTCCT GCGGCTACAC Genetic Code Biological Tools < WIRED BUSINESS Move Over, Jony Ive Biologists Are the Next Rock Star Designers GEAR DESIGN ENTERTAINMENT SCIENCE LIZ STINSON DESIGN 11.18.15 7:00 AM MOVE OVER, JONY IVE- BIOLOGISTS ARE THE NEXT ROCK STAR DESIGNERS The person who designs genetic architecture does so with aesthetic, utilitarian, and social considerations in mind. MAGGIE SHANNON FOR WIRED SUBSCRIBE "Ginkgo will organize the world's biological code and make it useful." O - GINKGO HEAD OF CODEBASE, PATRICK BOYLE RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 23#24IMAGE CREDIT: KAREN INGRAM CATTLE (BEEF & DAIRY) INDUSTRY: $1 trillion global market (¹) 9% of global greenhouse gas emissions(2) motif FOODWORKS AD FAST COMPANY This food tech startup just raised $90 million to make it easier to invent new plant-based meats (1) Source: imarc Group (February 2020) and Grandview Research (January 2019) (2) Source: Barclays Research (April 2019) CODEBASE We design codebase when working on programs EGG PROTEINS (1) MEAT PROTEINS (1) DAIRY PROTEINS (¹) (1) Note targets are illustrative as Motif has not announced specific products. AGTCGAGAG. ACTTCACTGAAGT AATTATACATGAGCTG CCTGATTTGCAACTTCCA AGAAATGTTCGGATGATAA CCTTTTGTGCCAACATATCA GGTGTCCAAAGAAAAGGCAA AGAGCTTGGGAATTGAGTTT ATTCCATTAGACATTAGCCT AAGGAAACAATTGAAAGC AAGGAAAAGAGTATCG" TTCTGAATGAGCAA TCTGCGTCACC MACAR Organisms like yeast (shown above) are the biological factories for producing a wide range of molecules 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 24#25TTTGCAAC ATGTTCGGATGAN TTTGTGCCAACATA1 TGTCCAAAGAAAAGGCA GAGCTTGGGAATTGAGTT TTCCATTAGACATTAGCC1 AAGGAAACAATTGAAAGCT GAAGGAAAAGAGTATCGT GCTTCTGAATGAGCAACA TGGTCTGCGTCACGGGT CCGGCTACATTGCTT TCGTCAAGCTCC GGCTACA We re-use codebase across programs to improve outcomes and efficiency COLLAGEN (1) (1) Note targets are illustrative as Kalo has not announced specific products. KERATIN (1) CODEBASE The SAME YEAST used to generate proteins for food can produce proteins used in personal care products, such as collagen, elastin, and keratin JUNE 2021 RAYMOND JAMES BIOWORKS GINKGO 25#26Ginkgo's virtuous cycle drives platform growth CODEBASE LOWER FOUNDRY COST STRUCTURE. IMPROVED PROGRAM TECHNICAL SUCCESS ADD NEW PROGRAM DEMAND FOR MORE PROGRAMS LOWER COST PER PROGRAM VALUE SHARE (ROYALTY/EQUITY) CUSTOMER VALUE PROPOSITION 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 26#27We believe... 1 Programming cells will be as impactful as programming computers 2 Ginkgo's platform improves with scale 3 Ginkgo is becoming the industry standar We believe Ginkgo's ecosystem of services will make us the obvious partner in the enormous, and largely untapped, market for cell programming. 4 Our value increases with each new program added to the platform RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 27#28Our ecosystem will soon support hundreds of new cell programs a year LOWER FOUNDRY COST STRUCTURE, New Programs by Year 600 500 400 300 200 100 0 CODEBASE Leverage Proof Points 17 4 2020A IMPROVED PROGRAM TECHNICAL SUCCESS ADD NEW PROGRAM ii Expand within Base DEMAND MORE PROGRAMS 23 2021E LOWER COST PER PROGRAM CUSTOMER VALVE VALUE SHARE (ROYALTY/EQUITY) PROPOSITION K Platform Scaling 60 2022P Ecosystem Support (1) Source: Piper Sandler Research; assumes each program is approximately $2M per year of cell engineering spend and growth estimate of 0% and 20% 136 2023P $ Self-Service Portals 268 2024P 508 Still only 1-2% of the market for cell engineering R&D services (1) 2025P 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 28#29Each new cell program can accelerate adoption within new markets and lead to further sales with existing customers # of Active Programs/ Yr (Customer X) 12 10 8 2 0 Ability to grow significantly within existing customer accounts Major Program Minor Program Proof of Concept Year 1 Year 2 Year 3 Year 4 Year 5 (1) Major programs typically incur well over $500K of annual R&D spending, minor programs are typically smaller add-on programs that have less than $500K of annual R&D spend, proof-of-concept programs are typically small programs that are often set up as a business development effort Early proof points within an industry can lead to follow-on demand moderna [CONFIDENTIAL] Optimizing pDNA production for another nucleic acid vaccine company [CONFIDENTIAL] In advanced discussions with leading pharmaceutical contract manufacturer RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 29#30Strong 2021 sales pipeline with mix of new customers and expanded relationships New multi-product collaboration with top global flavors & fragrances customer, building on successful historical program execution 100 Number of "Major" Pipeline Programs 50 [CONFIDENTIAL] 0 [key expansion areas] Skin microbiome Sustainability 15 Consumer & Technology Recycling Wastewater remediation Pulp/Paper 17 Industrial CORTEVA agriscience New relationship with top 5 agchem company, focused on discovery and development of crop protection agents Crop protection Renewable feedstocks 13 Agriculture 13 Cell & gene therapy Antibodies Nucleic acid therapeutics Antibiotic manufacturing Pharma & Biotech All Historical Programs Kalo Launched a new spin-out in personal care space, with strategic and financial investors 9 Sugar reduction Protein availability and functionality Food & Nutrition. 2021 6 Biogen New relationship with Biogen to develop a next-generation AAV production platform 95+ ~23 PROB. ADJ. 73 Government & Defense Cumulative Historical + 2021 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 30#31Ginkgo is creating the industry standard ecosystem Like other horizontal tech platforms, Ginkgo is building a strong developer community - wrapping services around the platform to drive industry growth and, ultimately, demand Launched Ginkgo Ferment, our annual conference, in 2018 AWS re: Invent Microsoft WWDC //build/ dreamforce Other leading developer conferences INDUSTRY MATURATION: WHAT'S NEXT FOR SYNBIO? MA CHA UNILEVER & GINKG RS RD JTHOR DMAN (ALIST & GINKGO FE EN 2 VIEW KEYNOTE 1 RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS ابن 31#32We will be greatly expanding our ecosystem of services for cell programmers running on the Ginkgo platform Mature manufacturing network across industries w/ clean tech-transfer protocols Capital Access + Foundry Credits CAPITAL MANUFACTURING ROBERTET GROUPE Ferment Consortium Open-source bioengineering tools Help drive legislative change for novel categories CRONOS GROUP FERMIC MEXICO Help clients file patents / protect IP REGULATORY COMMUNITY Ginkgo annual developer conference and product showcase GINKGO FERMENT OCTOBER 18 GINKGO FERMEN GINKGO BIOWORKS THE/ORGANISM COMPANY PARTNERS JOYN BIO Source of innovative technologies for industry partners: hub for investment, acquisition, and partnership motif Fonterra Dairy for life B BAYER I♥ GMO TRUST & CREDIBILITY Biosecurity ESG GROW RAYMOND JAMES | JUNE 20 21 GINKGO BIOWORKS 32#33We believe... 1 Programming cells will be as impactful as programming computers 2 Ginkgo's platform improves with scale 3 Ginkgo is becoming the industry standard 4 Our value increases with each new program added to the platform Each new program adds predictable near-term revenue from usage fees and provides Ginkgo upside through value share. RAYMOND JAMES | JUNE 20 21 GINKGO BIOWORKS 33#34Programs drive both predictable near-term revenues and long-term value creation with asymmetric upside potential Foundry Upfront payments to cover R&D costs for customer programs Yr 1 Foundry Yr 2 Yr 3 Highly predictable revenue stream independent of program success Note: Illustrative economics; variation exists between programs Yr 4 Downstream Value Value sharing via customer equity and/or royalties on completed programs Royalty Stream Yr 5 Yr 6 Yr 7 Yr 8... OR Yr 0 Equity Equity represents the risk- adjusted NPV of a potential royalty stream T--I Yr 4 Yr 5 I Yr 6 I I I 1 Yr 7 I 1 Yr 8... Cash flows from value share are typically 100% contribution margin as Ginkgo incurs minimal ongoing support or delivery costs The choice to structure downstream economics as royalties or equity is typically based on customer size 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 34#35Program unit economics are strong and improving % Cost Coverage of Programs(¹) Foundry Ginkgo has steadily increased the portion of program R&D costs that are covered upfront by customers 120% 100% 80% 60% 40% 20% 0% (2) Adj. for Free COVID Services ■% Direct Cost Coverage 14-15 16-17 18-19 Year Deal Signed 11 2020 Number of Major Programs Initiated Downstream Value Ginkgo receives downstream value in multiple forms. The equity value per program provides context for the future value. 100% 80% 60% 40% 20% 0% (1) Represents cumulative revenues from 2017-2020 for programs signed in the relevant year(s) divided by the total program expenses in 2017-2020 (2) Adjusts out expenses associated with programs Ginkgo performed under our free $25M commitment to COVID programs in spring 2020 (3) Includes one program for publicly-traded Cronos which is structured as a lump-sum equity payment upon delivery 54 Royalty / Other 20 Equity (3) 34 Major Programs (2017-2020) Ginkgo will recognize royalty revenues over time as programs are completed and commercialized The current equity value of our major programs is over $500M ...representing an average of $15M per program These should be roughly equivalent in value over the long- run, but royalties take longer to materialize 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 35#36Key Financial Metrics Foundry P&L Key Program Metrics ($M) Foundry Billable Revenue % growth memo: GAAP Adjustments Foundry Revenue (GAAP) (+) Biosecurity Total GAAP Revenue Adjusted EBITDA(1) Capital Expenditures(2) 2020(1) $64 18% ($4) $59 $17 $77 ($121) ($72) 2017-2020 20 Royalty 54 ~$15M(3) PLUS ~$500M(3) 34 Equity 2021 $100 57% $100 $50 $150 ($157) ($66) 2021 23 2022 $175 75% $175 # New Programs % growth Risk-Adjusted NPV / Program NPV of New Programs Signed (1) See Investor Presentation for a reconciliation of Net Income to Adjusted EBITDA for historical periods presented (2) 2020 CapEx of $72M includes $14M of CapEx that is included in Accounts Payable and Accrued Expenses at 12/31/2020 (3) Based on management estimate of the average current equity value of our cumulative major programs from 2017 to 2020 $175 ($156) ($118) 2023 $341 95% GAAP adjustments not projected $341 2024 $628 84% $628 Emerging business, projections not provided $628 ($47) ($193) $341 ($136) ($146) 2022 60 157% 2025 2024 268 97% $1,099 75% 2023 136 127% Increases if: p(success) increases, value of programs increases Decreases if: lower take rates, value of programs decreases # New Programs x NPV / Program $1,099 $1,099 $166 ($234) 2025 508 90% 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 36#37The most powerful technologies require the most care Our culture is built on care, transparency, diversity, employee ownership and a deep, humble respect for biology. We invest in our communities and their biosecurity as well as robust ESG practices. GROW THE BEAUTY ISSUE Concentric by Ginkgo: Lab Network Capacity In Discussion In Validation Validated READ MORE ABOUT: concentric by GINKGO We take care in considering which programs we pursue and which we do not, and explore the implications of biotechnologies through many forums, including our magazine: GROW ● Forbes This Biotech Company Is Giving $25 Million In Resources To Projects That Combat Coronavirus The meaning of nature after biotechnology ʼn The legacy of eugenics in beauty The role of the philosopher in the life sciences The potential for synthetic biology to save coral reefs The impact of the pandemic on scientists and science 2021 RAYMOND JAMES | JUNE GINKGO BIOWORKS 37#38We believe... 1 Programming cells will be as impactful as programming computers We hope... 2 Ginkgo's platform improves with scale 3 Ginkgo is becoming the industry standard ...that when technology meets biology, life finds a way. 4 Our value increases with each new program added to the platform Anna Marie Wagner, SVP Corporate Development [email protected] RAYMOND JAMES | JUNE 2021 GINKGO BIOWORKS 38

Download to PowerPoint

Download presentation as an editable powerpoint.

Related

Fiscal 3Q Investor Presentation image

Fiscal 3Q Investor Presentation

Healthcare

FY23 Full-Year Results Presentation image

FY23 Full-Year Results Presentation

Healthcare

Healthcare Network P&L Statement and Expansion Projects image

Healthcare Network P&L Statement and Expansion Projects

Healthcare

Accreditation and Quality Assurance Overview image

Accreditation and Quality Assurance Overview

Healthcare

Investment Highlights image

Investment Highlights

Healthcare

Investor Presentation image

Investor Presentation

Healthcare

IDEAYA Biosciences Interim IDE397 Phase 1 Clinical Data and Q1 2022 Corporate Update image

IDEAYA Biosciences Interim IDE397 Phase 1 Clinical Data and Q1 2022 Corporate Update

Healthcare

BioAtla Investor Presentation Deck image

BioAtla Investor Presentation Deck

Healthcare