#1GUARDANT ITM Guardant Health Investor Presentation January 2019#2Safe harbor statement This presentation contains "forward-looking statements," which are statements related to future events that by their nature address matters that are uncertain. All forward-looking information is inherently uncertain and actual results may differ materially from assumptions, estimates or expectations reflected or contained in the forward-looking statements as a result of various factors. For details on the uncertainties that may cause our actual results to be materially different than those expressed in our forward-looking statements, please refer to our reports filed with the Securities and Exchange Commission, including our quarterly report on Form 10-Q for the period ended September 30, 2018. Forward-looking statements address our expected future business, financial performance, financial condition as well as results of operations, and often contain words such as "intends," "estimates," "anticipates," "hopes," "projects," “plans,” “expects," "seek,” “believes," "see," “should,” “will,” “would,” “target,” and similar expressions and the negative versions thereof. Such statements are based only upon our current expectations. Any forward-looking statement speaks only as of the date made. Reliance should not be placed on forward-looking statements because they involve known and unknown risks, uncertainties and other factors which may cause actual results, performance or achievements to differ materially from those expressed or implied. Forward-looking statements include statements that address activities, events or developments that we expect, believes or anticipate will or may occur in the future. Forward-looking statements are based on our experience and perception of current conditions, trends, expected future developments and other factors we believe are appropriate under the circumstances and are subject to numerous risks and uncertainties, many of which are beyond our control. We undertake no obligation to publicly update or revise any forward-looking statements to reflect new information or future events or otherwise unless required by law. 2 GUARDANT™#3The mission of Guardant Health is to conquer cancer with data Expanding precision oncology to all stages of disease through easier access to cancer's underlying molecular information Market leading comprehensive liquid biopsy Therapy selection 6,000+ 50+ biopharma companies 80,000+ 94% tests ordered Revenue growth¹ oncologists GUARDANT 360 MN Recurrence monitoring LUNAR - 1 Early detection LUNAR - 2 1 YTD as of September 30, 2018 compared to nine-months ended 2017 3 GUARDANT#4Tumors shed cell-free nucleic acids into the blood at low concentrations Guardant proprietary technology unlocks these tumor signals from a simple blood draw LEN TUMOR 6000 4 GUARDANT#5Focused on expanding the scope of precision oncology Limitations of Current Approaches Patient Impact Therapy Selection Late-stage cancer patients Tissue Availability and Exhaustion Delay in Care 8% ******** iii of advanced NSCLC patients are tested for biomarkers in line with the NCCN Guidelines Recurrence Monitoring Cancer survivors Early Detection Asymptomatic individuals No Tissue Available High False Positive Rate Symptomatic Intervention. Low Compliance 56% tttttttt of colon cancer patients referred for disease recurrence have not had a recurrence 38% tttttttt of NSCLC patients are diagnosed with early stage disease GUARDANT Our Solution 360° Commercial 2014 MNI Commercial 2017 for research use LUNAR-1 LUNAR- 2 Rebecca L. Siegel, Cancer Statistics, 2018, A Cancer Journal for Clinicals, Gutierrez et al. 2017 Clinical Lung Cancer, PLOS ONE | DOI:10.1371/journal.pone.0171810 5 GUARDANT#6Realizing the $35B+ U.S. opportunity requires delivering the right information for the right intervention for the right patient population. U.S. Patient Population Advanced-Stage Cancer ~700 K Cancer Survivors ~15 million Asymptomatic, Hi-Risk ~35 million Therapy Selection Recurrence Monitoring Screening & Early Detection Information GUARDANT 360 OMN LUNAR -1 LUNAR-2 Intervention Targeted & Immuno- oncology therapies 50+ biopharma companies Neoadjuvant, Adjuvant, or Curative or Preventative Curative U.S. Market Size ~$6B ~$15B ~$18B Source: CDC Statistics; US Census; American Cancer Society, Cancer Facts and Statistics; SEER; Rebecca L. Siegel, Cancer Statistics, 2018, A Cancer Journal for Clinicals, 68:7; Piper Jaffray, Liquid Biopsy Report, Cowen Equity Research, Foundation Medicine, dated March 18, 2018; CDC, Viral Hepatitis and Liver Cancer report. Note: Market sizing based on Guardant Health internal analysis. 6 GUARDANT™#7Digital sequencing platform Patented proprietary technology for unlocking cancer's signals from blood GUARDANT DIGITAL SEQUENCING PLATFORM High- Efficiency Chemistry Next Generation Sequencing T» Learning Bioinformatics Engine TCAGCATTAGCTAGTGCGCTA AGOTAGCTAGCTAGTGCATG GCATCGCA Biochemistry Genomic sequencing Signal processing LUNAR-2 LUNAR - 1 GUARDANT OMNI TM GUARDANT 360" REPORTING PHYSICIAN Adde 310 Fax Summary of Somatic Aburation & Assosiated Treatment Options COPY TOM ar EGFREE A7500 ExonDeletor %COMA.or Associated FDA haples Own 224 N Cara avalability Erin Cink, M Yes Neatry Yes None Naty EML4-ALK Fusion AGGAGTGTG COWD A Median Pack C Bioinformatics Process engineering Machine learning 60+ PATENTS ISSUED AND 130+ PENDING PATENT APPLICATIONS P Now yoy Vee More Newly Vee None N We evaluated 73 ganes, including the following guidline-recommended genes for NSCLC: ALX ME RET 7 GUARDANT™#8Digital Sequencing Platform: underlying technology Guardant Digital Sequencing Biochemistry and Error Reduction High- Efficiency Chemistry Source: Odegaard et al. CCR, 2018. MOLECULE RECOVERY EFFICIENCY High-Efficiency Biochemistry 1.0- 2-3X conversion higher efficiency 0.9 than other methods 0.8- Learning Bioinformatics Engine 0.7 0.6 0.5 0.4. 5 CFDNA INPUT (NG) T ERROR RATE, LOG10 1000X reduction in sequencing error rate Learning Bioinformatics Engine -3.5- -4.0- -4.5- -5.0- -5.5- -6.0- -6.5- SE PE MOL DS Digital Sequencing unlocks signal from noise across all 4 classes of genomic alterations and MSI 100% • 60 9000 10% 1% 0.1% 0.01% Standard NGS 100% 00 000000 Guardant Digital Sequencing 10% Noise lowered by >3 orders of magnitude SNV 1% 0.1% 0.01% 8 GUARDANT#9Liquid biopsy for therapy selection in advanced cancer GUARDANT 360 Market leading Comprehensive Liquid Biopsy Guideline-complete clinical results for advanced solid tumors in less than 7 days GUARDANT OMNI TM >2MB footprint panel tailored for immuno- oncology and targeted therapy development GUARDANT 360 TM REPORTING Fal Report Dale: SEP-06-2018 Recept Date: AUG-31-2016 Collection Date MUD-00-2018 Specimen Status Blood PHYSICIAN Mary MO Account Boca Raton Regional Hostal Address: fat Street San Francisco, CA 94155 Ph: 310-829005 | Fax: 310291111 Apart Summary of Somatic Alterations & Associated Treatment Options KEM %IDNA or Amplification Approved in atter indication Associated FDA-approved theracles Clinical trial availability EGFR T790M 0.7% Oximet Yes Nearby Storih Gottinb. A Yes Nona Nearby EGFR E746 A750del 12.2% None EMLA-ALK Fusion 6.0% ♥Cris Ves None Nearby GOKS Action Medium (++) Palbocico EGFR Anication Low( Alati Caberartinb Yes None Nearby Nechumush, Ptumab TP53 7231 11.0% None Yes - None Nearby GLM MOTC P3852 Functional consequences and inca sgrisanes of strees union, Revance of therapies targeting these one ran This sequence change does not alter the ance and as posion and is ely to be a topic cacacoste We evaluated 73 genes, including the following guideline-recommended genes for NSCLC ЕСНЯ (стем на EAREZ (HER) ALK ROST BRAF MERCK AstraZeneca MERCK Pfizer Bristol-Myers Squibb 9 GUARDANT™#10Guardant360 clinical data highlights 42 Clinical studies 98 Peer-reviewed Publications JAMA Oncology nature medicine Clinical Cancer Research The Journal of Clinical and Translational Research nature genetics Durian genome Enhancer connectome Pangenome graphs 295 Scientific abstracts CANCER DISCOVERY JANUARY 2018 VOLUME NUMBER L Al accelerates diagnosis NAD biosynthesis and high-risk hospitalizations Targeted microbiome therapy for thrombosis AAGR AAGR ociation for Cancer Research 10 GUARDANT™#11JAMA Oncology: Support for a blood first paradigm in NSCLC University of Pennsylvania study of 323 NSCLC Patients tested with Guardant360 44% ~90% 2x of eligible patients didn't get results from tissue biopsy Concordance at diagnosis reported for Guardant360Ⓡ and tissue testing The number of patients found with targetable mutations 82 patients with Guardant360Ⓡ + tissue testing versus 47 patients with tissue testing alone "These results [Aggarawal et al], combined with the patient satisfaction with the relative ease of providing blood rather than a solid tissue sample, suggest a clinical strategy of pursuing plasma NGS first, then tissue NGS if plasma NGS cannot detect relevant mutations." - Gyawali B and West J, JAMA Oncology, 2018 11 GUARDANT#12NILE: Guardant360 vs standard of care in 1st-line NSCLC Readout of primary endpoint expected in 1H 2019 300 NSCLC Patients Prospective, Multi-Center Trial Standard of Care Tissue Testing + GUARDANT 360 ↓ Detection of NCCN Biomarkers with Tissue Testing VS Detection of NCCN Biomarkers with GUARDANT,360 12 GUARDANT™#13Establishing a blood first paradigm in advanced cancer NILE Guardant360 FDA Approval Interim Readout 1H 2019 PMA Submission 1H 2019 <7-day TAT Pan-Cancer Medicare Coverage Post FDA Approval via the NGS NCD GUARDANT™#14Medicare and strong private payer coverage today and opportunity for increased coverage post FDA approval Q2 2016 Q3 2017 Q4 2017 Q1 2018 Q3 2018 Q4 2018 Priority Health CareFirst Cigna MASSACHUSETTS South Carolina HUMAN SERVICES USA UPMC Medicare BlueCross BlueShield Association FLORIDA Horizon blue california ® Total Covered Lives (Estimated) 700K 3.7M 6.9M 21.9M 89.9M Estimates for Q2 2016 through Q4 2019 are as of 1/04/2019 115.3M 14 GUARDANT™#15Biopharma is a significant portion of $6B therapy selection market 1200+ targeted therapy and I-O programs 130,000+ patients ~$4 Billion Clinical Opportunity ~$2 Billion Biopharmaceutical Opportunity 50+ $250 $320 pharma partners $370 $1,180 Prospective Retrospective CDx Commercial Sources: SEER; Rebecca L. Siegel, Cancer Statistics, 2018, A Cancer Journal for Clinicians, 68:7; Piper Jaffray, Liquid Biopsy Report. Guardant Health Biopharma, Global Data, June 2017; clinicaltrials.gov; Campbell (Meyerson) and TCGA 2016 Nature Genetics. 15 GUARDANT™ Note: Market sizing based on Guardant Health internal analysis.#16Partnership with AstraZeneca to develop multiple plasma- based companion diagnostic tests TAGRISSOⓇ osimertinib GUARDANT 360 SIMFINZIⓇ durvalumab Injection for Intravenous Use 50 mg/mL GUARDANT OMNI TM 16 GUARDANT™#17AstraZeneca Partnership: Guardant found more patients who may benefit from combination immunotherapy Evaluable Patients for TMB analysis Guardant TMB High Overall Survival 460 Tissue TMB Annals of Oncology, Volume 29, Issue suppl_10, 1 December 2018 809 GUARDANT OMNI Probability of OS Durvalumab + Durvalumab tremelimumab Chemotherapy 1.0. 0.8- MOS, months (95% CI) HR vs CT* (95% CI) (n=111) (n=106) 11.0 16.5 (7.8-16.1) (10.3-22.9) 0.80 0.62 (0.588-1.077) (0.451-0.855) (n=102) 10.5 (8.8-12.4) 0.6' 39% 0.4- 0.2- 18% 0.0 03 6 9 12 15 18 21 24 27 30 33 36 Time from randomisation (months) 17 GUARDANT#18LUN R To develop affordable multi-cancer assays for early detection and recurrence monitoring Lung CRC THE UNIVERSITY OF TEXAS MD Anderson Cancer Center <II+ 1884 Memorial Sloan Kettering UCSF Cancer Center Breast Ovarian University of California San Francisco Wake ForestⓇ Baptist Medical Center A MGH 1811 MASSACHUSETTS GENERAL HOSPITAL 18 University of Colorado Anschutz Medical Campus GUARDANT#19Commercial engine as a significant R&D force multiplier Force multiplier GUARDANT 360 GUARDANT MN LUNAR-1 LUNAR-1 Products GuardantOMNI Guardant360 Direct R&D 80,000+ sample data & biobank Leveraging data, biobank and insights produced by commercial engine can create technology compounding effect 19 GUARDANT#20The challenges of detecting residual disease using cell-free DNA with high sensitivity and high specificity Detection Challenges Genomic Signatures Sensitivity Genomic signatures alone max out TUMOR + Epigenomic Signatures MICRO- ENVIRONMENT at-50% sensitivity for early cancer Specificity Non-tumor sources of biological noise, such as CHIP, can increase difficulty of highly specific detection Using prior knowledge of tumor tissue to filter out such noise is clinically challenging 20 GUARDANT™#21Introducing the LUNAR assay LUNAR now available for research use by biopharmaceutical and academic researchers Genomic Alterations Biological Noise Filter 80,000 GUARDANT 360 + Tests ctDNA Whole Genome Sequencing Epigenomic Signatures Pub Med LUNAR TEST RESULT + Signal Integration TCGAⒸ ctDNA present / absent Epigenomic Classifier Launched for RUO in Q4'18 and planned CLIA launch for prospective studies in 2H'19 21 GUARDANT#22LUNAR Assay Performance Hybrid genomics and epigenomics approach can improve sensitivity to early stage cancers Internal Guardant Health data Genomic Alterations 100 10 T 0.1 0.01 0.001 0.0001 0.00001 0.000001 Normal Late-stage Early-stage 0.000001 0.00001 0.0001 0.001 TTTTT 0.01 0.1 1 Epigenomic Signatures . • Assay reportable range down to 0.01% for genomic alterations High quantitative correlation between genomic and epigenomic signal components Epigenomic component detects many samples that were negative with genomics-only component 22 GUARDANT™#23LUNAR- 1: Selecting patients with residual disease for adjuvant therapy may improve outcomes in multiple cancers Breast e.g., Herceptin Nearly 50% reduction in risk of recurrence(1) (1) N Engl J Med 2005;353:1659-72. Lung CRC Ovarian No well-defined standard for accurately selecting patients for adjuvant therapy 23 GUARDANT#24LUNAR- 1: Detection of post-op residual disease in CRC and NSCLC Study of colorectal cancer patients over 5 years • Design • Retrospective surgical CRC study with 5 year follow-up Patients going through curative-intent hepatectomy Study of resected early-stage NSCLC Prospective, comprehensive profiling 19.4 months follow-up Design ctDNA assessment of MRD pre- and post-op at 4 weeks and until recurrence Results Residual Free Survival 10 0.8 0.6 0.4 0.2 not detected detected 0.0- 30 0 10 20 40 50 Months ctDNA detected in 84% of pre-op samples All patients with detected ctDNA using LUNAR assay post-op relapsed (48% sens / 100% spec) Results • Recurrence free survival (% of patients) 1.00- 0.75- 0.50- 4wk ctDNA not detected 0.25- 4wk ctDNA detected HR 4.68 (1.55 - 14.16) p = 0.003 by log-rank 0.00- 12 18 24 Months H Somatic panel with classifier to filter non-tumor variants ctDNA detected in 69% evaluable patients prior to/at time of recurrence ctDNA detected post-op four months earlier than radiographic recurrence Overman (Kopetz) et al. Jun 2018 J Clin Oncol 36, 2018 (suppl; abstr 12044) Lam (Heymach) et al. Sep 2018 WCLC 24 GUARDANT#25LUNAR- 2: Addressing need for improved early cancer detection Pilot data has demonstrated strong performance in early detection of lung cancer LUNAR-2 Lung Sensitivity by Stage Sensitivity at around 98% specificity 100% 80% 60% 40% 20% 0% STAGE 1 STAGE 2 Note: The pilot data presented here may be impacted by small sample sizes, non-ideally matched and unblinded controls, and potentially other confounding factors. Further studies are required to verify the presented performance. 25 GUARDANT™#26Strong financial profile Revenues ($000's) Sample Volumes (1) BioPharma Clinical $29,840 2017 Q3 YTD +94% $57,766 2018 Q3 YTD 20,960 17,304 (+33% 27,981 Gross Profit Margin (2) 20,644 24.7% 7,337 3,656 2017 Q3 YTD 2018 Q3 YTD (1) Clinical volume excludes 352 and 1,382 tests in the first nine months of 2018 and 2017, respectively, from a customer that in March 2018 began processing tests in-house (2) Gross profit margin = gross profit / total revenue Gross profit Total revenue - Cost of precision oncology testing - Cost of development services 2017 Q3 YTD +100% 49.3% 2018 Q3 YTD 26 GUARDANT#27Significant opportunities to drive future growth. OMNI FDA approval Medicare NCD (pan-cancer) Commercial payer reimbursement Pharma CDx Medicare LCD (lung) tailwinds Near-term drivers Blood-First Volume Growth GUARDANT 360 OMNI LUNAR-2 LUNAR-1 Increased International expansion Continued COGS and adoption of CGP opex leverage 27 Long-term drivers GUARDANT#28● GUARDANT TM