Guardant Health Investor Presentation slide image

Guardant Health Investor Presentation

Digital sequencing platform Patented proprietary technology for unlocking cancer's signals from blood GUARDANT DIGITAL SEQUENCING PLATFORM High- Efficiency Chemistry Next Generation Sequencing T» Learning Bioinformatics Engine TCAGCATTAGCTAGTGCGCTA AGOTAGCTAGCTAGTGCATG GCATCGCA Biochemistry Genomic sequencing Signal processing LUNAR-2 LUNAR - 1 GUARDANT OMNI TM GUARDANT 360" REPORTING PHYSICIAN Adde 310 Fax Summary of Somatic Aburation & Assosiated Treatment Options COPY TOM ar EGFREE A7500 ExonDeletor %COMA.or Associated FDA haples Own 224 N Cara avalability Erin Cink, M Yes Neatry Yes None Naty EML4-ALK Fusion AGGAGTGTG COWD A Median Pack C Bioinformatics Process engineering Machine learning 60+ PATENTS ISSUED AND 130+ PENDING PATENT APPLICATIONS P Now yoy Vee More Newly Vee None N We evaluated 73 ganes, including the following guidline-recommended genes for NSCLC: ALX ME RET 7 GUARDANT™
View entire presentation